48 well membrane tray (Gel Company Inc)
90
Structured Review
Gel Company Inc
48 well membrane tray
48 Well Membrane Tray, supplied by Gel Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/48+well+membrane+tray/48+well+membrane+tray/us07727720-1258-24-28
Average 90 stars, based on 1 article reviews
48 Well Membrane Tray, supplied by Gel Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/48+well+membrane+tray/48+well+membrane+tray/us07727720-1258-24-28
Average 90 stars, based on 1 article reviews
48 well membrane tray - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: Methods for detection of genetic disorders Article Snippet: Primer Design SNP TSC 0087315 was amplified using the following primers: First primer: 5′ TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC 3′ (SEQ ID NO: 15) Second primer: 5′ TGGACCATAAACGGCCAAAAACTGTAAG 3′. (SEQ ID NO: 16) SNP TSC0214366 was amplified using the following primers: First primer: 5′ ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA 3′ (SEQ ID NO: 13) Second primer: 5′ GAGAATTAGAACGGCCCAAATCCCACTC 3′ (SEQ ID NO: 14) SNP TSC 0413944 was amplified with the following primers: First primer: 5′ TACCTTTTGATCGAATTCAAGGCCAAAAATATTAAGTT 3′ (SEQ ID NO: 23) Second primer: 5′ TCGAACTTTAACGGCCTTAGAGTAGAGA 3′ (SEQ ID NO: 24) SNP TSC0095512 was amplified using the following primers: First primer: 5′ AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG 3′ (SEQ ID NO: 11) Second primer: 5′ TCTCCAACTAACGGCTCATCGAGTAAAG 3′ (SEQ ID NO: 12) SNP HC21S00131 was amplified with the following primers: First primer: 5′ CGATTTCGATAAGAATTCAAAAGCAGTTCTTAGTTCAG 3′ (SEQ ID NO: 25) Second primer: 5′ TGCGAATCTTACGGCTGCATCACATTCA 3′ (SEQ ID NO: 26) SNP HC21S00027 was amplified with the following primers: First primer: 5′ ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3′ (SEQ ID NO: 17) Second primer: 5′ CTTAAATCAGACGGCTAGGTAAACTTCA 3′ (SEQ ID NO: 19) For each SNP, the first primer contained a recognition site for the restriction enzyme EcoRI and had a biotin tag at the extreme 5′ end. Membrane:Article Title: Methods for detection of genetic disorders Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 Article Title: Rapid analysis of variations in a genome Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 Article Title: Methods for detection of genetic disorders Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 3 μl of the 10 μl sample was loaded in a 48 Article Title: Methods for detection of genetic disorders Article Snippet: Each PCR product was divided into four separate reaction wells of a Streptawell, transparent, High-Bind plate from Roche Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular Biochemicals, 2001 Biochemicals Catalog). .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 Article Title: Methods for detection of genetic disorders Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 3 μl of the 10 μl sample was loaded in a 48 Article Title: Methods for detection of genetic disorders Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 |