Review




Structured Review

Gel Company Inc 48 well membrane tray
48 Well Membrane Tray, supplied by Gel Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/48+well+membrane+tray/48+well+membrane+tray/us07727720-1258-24-28
Average 90 stars, based on 1 article reviews
48 well membrane tray - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Methods for detection of genetic disorders
Article Snippet: Primer Design SNP TSC 0087315 was amplified using the following primers: First primer: 5′ TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC 3′ (SEQ ID NO: 15) Second primer: 5′ TGGACCATAAACGGCCAAAAACTGTAAG 3′. (SEQ ID NO: 16) SNP TSC0214366 was amplified using the following primers: First primer: 5′ ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA 3′ (SEQ ID NO: 13) Second primer: 5′ GAGAATTAGAACGGCCCAAATCCCACTC 3′ (SEQ ID NO: 14) SNP TSC 0413944 was amplified with the following primers: First primer: 5′ TACCTTTTGATCGAATTCAAGGCCAAAAATATTAAGTT 3′ (SEQ ID NO: 23) Second primer: 5′ TCGAACTTTAACGGCCTTAGAGTAGAGA 3′ (SEQ ID NO: 24) SNP TSC0095512 was amplified using the following primers: First primer: 5′ AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG 3′ (SEQ ID NO: 11) Second primer: 5′ TCTCCAACTAACGGCTCATCGAGTAAAG 3′ (SEQ ID NO: 12) SNP HC21S00131 was amplified with the following primers: First primer: 5′ CGATTTCGATAAGAATTCAAAAGCAGTTCTTAGTTCAG 3′ (SEQ ID NO: 25) Second primer: 5′ TGCGAATCTTACGGCTGCATCACATTCA 3′ (SEQ ID NO: 26) SNP HC21S00027 was amplified with the following primers: First primer: 5′ ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3′ (SEQ ID NO: 17) Second primer: 5′ CTTAAATCAGACGGCTAGGTAAACTTCA 3′ (SEQ ID NO: 19) For each SNP, the first primer contained a recognition site for the restriction enzyme EcoRI and had a biotin tag at the extreme 5′ end.

Membrane:

Article Title: Methods for detection of genetic disorders
Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-0l). .. The sample in the tray was absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691).

Article Title: Rapid analysis of variations in a genome
Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-01). .. The sample in the tray was absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691).

Article Title: Methods for detection of genetic disorders
Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-01). .. The sample in the tray was absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691).

Article Title: Methods for detection of genetic disorders
Article Snippet: Each PCR product was divided into four separate reaction wells of a Streptawell, transparent, High-Bind plate from Roche Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular Biochemicals, 2001 Biochemicals Catalog). .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-01). .. The sample in the tray was absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691).

Article Title: Methods for detection of genetic disorders
Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-01). .. Template DNA was isolated using QIAamp DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).

Article Title: Methods for detection of genetic disorders
Article Snippet: .. Detection of the Locus of Interest After release from the streptavidin matrix, 2-3 μl of the 10 μl sample was loaded in a 48 well membrane tray (The Gel Company, catalog number TAM48-01). .. The sample in the tray was absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48), and inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691).



Similar Products

90
Gel Company Inc 48 well membrane tray
48 Well Membrane Tray, supplied by Gel Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/48+well+membrane+tray/48+well+membrane+tray/us07727720-1258-24-28
Average 90 stars, based on 1 article reviews
48 well membrane tray - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results